Review




Structured Review

Benchling Inc crispr guide rna design tools benchling
Crispr Guide Rna Design Tools Benchling, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna+benchling/crispr+design+tool/pm42277432-365-25-30
Average 86 stars, based on 1 article reviews
crispr guide rna design tools benchling - by Bioz Stars, 2026-10
86/100 stars

Images

Related Articles

Sequencing:

Article Title: Macrophages Promote Tumor Cell Extravasation across an Endothelial Barrier through Thin Membranous Connections.
Article Snippet: In brief, a guide RNA (gRNA) targeting exon2 of TNFAIP2 gene, Tnfaip2 Ex2 gRNA 62/85 (targeting sequence: aaagccacgctctacatccgagg) was designed by online software Benchling (www.benchling.com, accessed on 6 March 2019, San Francisco, CA, USA) and generated by in vitro transcription.

Article Title: Deubiquitylase UCHL3 regulates bi‐orientation and segregation of chromosomes during mitosis
Article Snippet: For generating HeLa UCHL3−/− cell lines, guide RNA (gRNA) was designed by online software Benchling (https://www.

Software:

Article Title: Macrophages Promote Tumor Cell Extravasation across an Endothelial Barrier through Thin Membranous Connections.
Article Snippet: In brief, a guide RNA (gRNA) targeting exon2 of TNFAIP2 gene, Tnfaip2 Ex2 gRNA 62/85 (targeting sequence: aaagccacgctctacatccgagg) was designed by online software Benchling (www.benchling.com, accessed on 6 March 2019, San Francisco, CA, USA) and generated by in vitro transcription.

Article Title: Deubiquitylase UCHL3 regulates bi‐orientation and segregation of chromosomes during mitosis
Article Snippet: For generating HeLa UCHL3−/− cell lines, guide RNA (gRNA) was designed by online software Benchling (https://www.

Generated:

Article Title: Macrophages Promote Tumor Cell Extravasation across an Endothelial Barrier through Thin Membranous Connections.
Article Snippet: In brief, a guide RNA (gRNA) targeting exon2 of TNFAIP2 gene, Tnfaip2 Ex2 gRNA 62/85 (targeting sequence: aaagccacgctctacatccgagg) was designed by online software Benchling (www.benchling.com, accessed on 6 March 2019, San Francisco, CA, USA) and generated by in vitro transcription.

Article Title: Deubiquitylase UCHL3 regulates bi‐orientation and segregation of chromosomes during mitosis
Article Snippet: For generating HeLa UCHL3−/− cell lines, guide RNA (gRNA) was designed by online software Benchling (https://www.

In Vitro:

Article Title: Macrophages Promote Tumor Cell Extravasation across an Endothelial Barrier through Thin Membranous Connections.
Article Snippet: In brief, a guide RNA (gRNA) targeting exon2 of TNFAIP2 gene, Tnfaip2 Ex2 gRNA 62/85 (targeting sequence: aaagccacgctctacatccgagg) was designed by online software Benchling (www.benchling.com, accessed on 6 March 2019, San Francisco, CA, USA) and generated by in vitro transcription.

Article Title: Deubiquitylase UCHL3 regulates bi‐orientation and segregation of chromosomes during mitosis
Article Snippet: For generating HeLa UCHL3−/− cell lines, guide RNA (gRNA) was designed by online software Benchling (https://www.

Clone Assay:

Article Title: Macrophages Promote Tumor Cell Extravasation across an Endothelial Barrier through Thin Membranous Connections.
Article Snippet: In brief, a guide RNA (gRNA) targeting exon2 of TNFAIP2 gene, Tnfaip2 Ex2 gRNA 62/85 (targeting sequence: aaagccacgctctacatccgagg) was designed by online software Benchling (www.benchling.com, accessed on 6 March 2019, San Francisco, CA, USA) and generated by in vitro transcription.

Article Title: Deubiquitylase UCHL3 regulates bi‐orientation and segregation of chromosomes during mitosis
Article Snippet: For generating HeLa UCHL3−/− cell lines, guide RNA (gRNA) was designed by online software Benchling (https://www.

Ligation:

Article Title: Macrophages Promote Tumor Cell Extravasation across an Endothelial Barrier through Thin Membranous Connections.
Article Snippet: In brief, a guide RNA (gRNA) targeting exon2 of TNFAIP2 gene, Tnfaip2 Ex2 gRNA 62/85 (targeting sequence: aaagccacgctctacatccgagg) was designed by online software Benchling (www.benchling.com, accessed on 6 March 2019, San Francisco, CA, USA) and generated by in vitro transcription.

Article Title: Deubiquitylase UCHL3 regulates bi‐orientation and segregation of chromosomes during mitosis
Article Snippet: For generating HeLa UCHL3−/− cell lines, guide RNA (gRNA) was designed by online software Benchling (https://www.

Cell Culture:

Article Title: Macrophages Promote Tumor Cell Extravasation across an Endothelial Barrier through Thin Membranous Connections.
Article Snippet: In brief, a guide RNA (gRNA) targeting exon2 of TNFAIP2 gene, Tnfaip2 Ex2 gRNA 62/85 (targeting sequence: aaagccacgctctacatccgagg) was designed by online software Benchling (www.benchling.com, accessed on 6 March 2019, San Francisco, CA, USA) and generated by in vitro transcription.

Article Title: Deubiquitylase UCHL3 regulates bi‐orientation and segregation of chromosomes during mitosis
Article Snippet: For generating HeLa UCHL3−/− cell lines, guide RNA (gRNA) was designed by online software Benchling (https://www.



Similar Products

86
Benchling Inc crispr guide rna design tools benchling
Crispr Guide Rna Design Tools Benchling, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna+benchling/crispr+design+tool/pm42277432-365-25-30
Average 86 stars, based on 1 article reviews
crispr guide rna design tools benchling - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

86
Benchling Inc crispr guide rna design tool within benchling
Crispr Guide Rna Design Tool Within Benchling, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna+benchling/crispr+design+tool/pm41667051-76-6-12
Average 86 stars, based on 1 article reviews
crispr guide rna design tool within benchling - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

86
Benchling Inc crispr guide rna design tool benchling
Crispr Guide Rna Design Tool Benchling, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna+benchling/crispr+design+tool/bio_rxiv__2025__11__26__690770-214-26-31
Average 86 stars, based on 1 article reviews
crispr guide rna design tool benchling - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

86
Benchling Inc algorithms benchling crispr guide rna design tool
Algorithms Benchling Crispr Guide Rna Design Tool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna+benchling/crispr+design+tool/pm41241939-242-89-90
Average 86 stars, based on 1 article reviews
algorithms benchling crispr guide rna design tool - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

90
Benchling Inc single guide rna benchling crispr design tool
Single Guide Rna Benchling Crispr Design Tool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna+benchling/crispr+design+tool/pm39561221-298-14-14
Average 90 stars, based on 1 article reviews
single guide rna benchling crispr design tool - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Benchling Inc guide rna benchling
Guide Rna Benchling, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna+benchling/guide+rna+benchling/pm37046751-74-7-23
Average 90 stars, based on 1 article reviews
guide rna benchling - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Benchling Inc single-guide rna (sgrna) designed using the benchling tool
Single Guide Rna (Sgrna) Designed Using The Benchling Tool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna+benchling/single+guide+rnas/pm35733338-26-23-25
Average 90 stars, based on 1 article reviews
single-guide rna (sgrna) designed using the benchling tool - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Benchling Inc guide rna benchling 5′-gccctctctcctatcgcccg-3′
Guide Rna Benchling 5′ Gccctctctcctatcgcccg 3′, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna+benchling/guide+rna+benchling+5++gccctctctcctatcgcccg+3+/pm36198679-344-2-29
Average 90 stars, based on 1 article reviews
guide rna benchling 5′-gccctctctcctatcgcccg-3′ - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Benchling Inc crispr guide rnas (grnas) designed using the benchling online tool
Crispr Guide Rnas (Grnas) Designed Using The Benchling Online Tool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna+benchling/crispr+guides/pm35999394-392-8-12
Average 90 stars, based on 1 article reviews
crispr guide rnas (grnas) designed using the benchling online tool - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

86
Benchling Inc crispr guide rna design tool in benchling
Crispr Guide Rna Design Tool In Benchling, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna+benchling/crispr+design+tool/pm33666542-162-40-46
Average 86 stars, based on 1 article reviews
crispr guide rna design tool in benchling - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

Image Search Results